Quick Order |All Online Ordering|Product Catalog Ordering|Oligo Modifications List|Product Info & Literature|Oligo Design Tools/Resources

Multiple Oligo Blast:

1. Directly import excel file using the browse button below. Please name your worksheet Sheet1 (no spaces) and include a header row with the following column names.

Oligo Count (Column A) Oligo Name (Column B) Sequence(5'-3') (Column C) Comments (Column D)

more info

Other Options

2. Four fields per line containing
Oligo Count; Oligo Name; Oligo Sequence; any comments
The fields maybe be seperated by commas(,) - TAB - semicolon(;) - colon(:) DOUBLE SPACE( )
Example using (:)
1:PrimerDB1:AGTAGTAGAGATGATAGATAGTAGATA: your own comments here

3. Highlight cells in excel and copy-paste below. Please include a header row as shown above.

Oligonucleotide Synthesis |  Flourescent Molecular Probes |  Gene Detection Systems |  Tools & Reagents |  Gene Assays |  RNAi
© 2017 Gene Link |  Terms & Conditions |  Licenses |  Privacy Policy |  April 25, 2017 3:27:58 PM