Home  | Products | Tools | Literature | Contact Us  | Custom Oligo Order  | Sequencing Orders  | Catalog Orders 
Multiple Oligo Blast:

1. Directly import excel file using the browse button below. Please name your worksheet Sheet1 (no spaces) and include a header row with the following column names.

Oligo Count (Column A) Oligo Name (Column B) Sequence(5'-3') (Column C) Comments (Column D) more info

Other Options

2. Four fields per line containing
Oligo Count; Oligo Name; Oligo Sequence; any comments
The fields maybe be seperated by commas(,) - TAB - semicolon(;) - colon(:) DOUBLE SPACE( )
 Example using (:)
1:PrimerDB1:AGTAGTAGAGATGATAGATAGTAGATA: your own comments here
2:PrimerDB2:AGTAGTGCCGTAGATGCTGATGCTGAT: please gel purify
 OR

3. Highlight cells in excel and copy-paste below. Please include a header row as shown above.